Question: Fetching Promoters
0
gravatar for Linda Barnum
8.9 years ago by
Linda Barnum • 60
Linda Barnum • 60 wrote:
Hello, Is there a way to fetch the promoter regions for homologous genes from different species. E.g. say I'd like to fetch the promoter region for a drosophila gene CG13222 from drosophila as well as its CG13222 homologues in other flies from UCSC genome browser? Thanks, Lin
• 983 views
ADD COMMENT • link • modified 8.9 years ago by Anton Nekrutenko ♦ 1.7k • written 8.9 years ago by Linda Barnum • 60
0
gravatar for Anton Nekrutenko
8.9 years ago by
Penn State
Anton Nekrutenko ♦ 1.7k wrote:
Linda: Suppose you want to fetch sequences of homologous promoters for all Drosophila genes. Here is an outline of how to do this: 1. Download coordinates of flybase genes from Drosophila melanogaster dm2 genome build (see attached images 1 and 2). 2. Use "Operate on Genomic Intervals -> Get Flanks" to convert coordinates of genes into coordinates of putative promoters by taking 500 bp upstream of each gene (see attached images 3). 3. Use "Fetch alignments -> Stitch MAF blocks" to retrieve homologous sequences for several species (see attached image 4). You will get alignments in FASTA format corresponding to your promoters. They will look like this: CAAAGAGCGTCTCTCCGTCATCTCTATTCACGGCGTAGACCGTGAACCCGTAGCCGG CAAAAAGCGTCTCTCCGTCATCTCTTTTTACGGCGTATGCGGTGAATCCGTACCCGG CAAAGAGCGTCTCGCCGTCGGAGCGCTGGACAGCGTAGGCGGTGAAGCCATAACCAG Let us know you have problems. Thanks, anton galaxy team
ADD COMMENT • link written 8.9 years ago by Anton Nekrutenko ♦ 1.7k
Hi Linda, Multiz 15-way alignments for dm3 are now available for use on the test instance of Galaxy located at http://test.g2.bx.psu.edu/. They'll be made available on our main server shortly. Thanks, Guru Galaxy team. Guruprasad Ananda Graduate Student Bioinformatics and Genomics The Pennsylvania State University
ADD REPLY • link written 8.9 years ago by Guruprasad Ananda • 230
0
gravatar for Anton Nekrutenko
8.9 years ago by
Penn State
Anton Nekrutenko ♦ 1.7k wrote:
Yes. This will be happening shortly. a. Anton Nekrutenko http://nekrut.bx.psu.edu http://galaxyproject.org
ADD COMMENT • link written 8.9 years ago by Anton Nekrutenko ♦ 1.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 178 users visited in the last hour