Question: Bowtie Raw Input
0
gravatar for Jonathan Glass
5.1 years ago by
Jonathan Glass • 20 wrote:
Hi There Im trying to map RNA-seq data to a reference genome in Galaxy (Main instance) using both Bowtie 1 and Bowtie 2. Im currently using publicly available data (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28755) which is not available in FASTQ format - only the raw sequences with the read count. Is there a way to set the input data for bowtie to raw, as is possible using the terminal? Or is there a way to convert a raw sequence to FASTQ (not sure if this would work, but it might be possible if I assigned accession numbers to each sequence and made all the quality scores identical)? Thanks very much Jonathan Glass Disclaimer - University of Cape Town This e-mail is subject to the UCT ICT policies and e-mail disclaimer published on our website at http://www.uct.ac.za/about/policies/emaildisclaimer/ or obtainable from +27 21 650 9111. If this e-mail is not related to the business of UCT it is sent by the sender in the sender's individual capacity.
alignment bowtie • 991 views
ADD COMMENT • link • modified 5.1 years ago by Jennifer Hillman Jackson ♦ 25k • written 5.1 years ago by Jonathan Glass • 20
0
gravatar for Jennifer Hillman Jackson
5.1 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello, This is one of the files? GSM803805_ZMR3_trimmed.txt.gz ID = Unique sequences identified ZMR3_raw = Abundance count (raw value) ZMR3 = Abundance count (tags per million) ID ZMR3_raw ZMR3 TCAAGATTGCATGTAGAAGAGGAAA 1 1 AAGATAGAAGTCAAACACGTT 1 1 AAGCAATTCGAAGGTCGT 1 1 CGAACGAAGATCGCTCACGATC 1 1 GACTGTTGTGGATGATTACTCTAG 1 1 GGAGATCGTGGCTAAGACTT 1 1 AAGCTAATGTGAACTCTGA 1 1 TGTGAGCATACCTGTCGGGACTCGTATG 1 1 Yes, you can create a FASTQ file from this. Tools under "Text or FASTA Manipulation" unless noted. 0 - Load the file(s) 1 - 'Add column' starting with 1 and choosing to increment. This assigns a unique identifier. Or add in any other type that you want - tools in this same tool group can help rearrange data. 2 - 'Cut' out the fourth and first column (result: identifier <tab> sequence). 3 - use 'Tabular-to-FASTA' 4 - Use the tool "'NGS: QC and manipulation: Combine FASTA and QUAL into FASTQ'. Do not choose a quality score file. 5 - Double check the datatype is ".fastqsanger" and reassign the "database" as needed. 6 - Optional: extract a workflow (History menu) from the method the first time through, save, and run on subsequent files. Hopefully this helps, Jen Galaxy team -- Jennifer Hillman-Jackson http://galaxyproject.org
ADD COMMENT • link written 5.1 years ago by Jennifer Hillman Jackson ♦ 25k
Hi Jen That looks fantastic, thank you. Hopefully this solves my problem :) Cheers, Jon Hello, This is one of the files? GSM803805_ZMR3_trimmed.txt.gz ID = Unique sequences identified ZMR3_raw = Abundance count (raw value) ZMR3 = Abundance count (tags per million) ID ZMR3_raw ZMR3 TCAAGATTGCATGTAGAAGAGGAAA 1 1 AAGATAGAAGTCAAACACGTT 1 1 AAGCAATTCGAAGGTCGT 1 1 CGAACGAAGATCGCTCACGATC 1 1 GACTGTTGTGGATGATTACTCTAG 1 1 GGAGATCGTGGCTAAGACTT 1 1 AAGCTAATGTGAACTCTGA 1 1 TGTGAGCATACCTGTCGGGACTCGTATG 1 1 Yes, you can create a FASTQ file from this. Tools under "Text or FASTA Manipulation" unless noted. 0 - Load the file(s) 1 - 'Add column' starting with 1 and choosing to increment. This assigns a unique identifier. Or add in any other type that you want - tools in this same tool group can help rearrange data. 2 - 'Cut' out the fourth and first column (result: identifier <tab> sequence). 3 - use 'Tabular-to-FASTA' 4 - Use the tool "'NGS: QC and manipulation: Combine FASTA and QUAL into FASTQ'. Do not choose a quality score file. 5 - Double check the datatype is ".fastqsanger" and reassign the "database" as needed. 6 - Optional: extract a workflow (History menu) from the method the first time through, save, and run on subsequent files. Hopefully this helps, Jen Galaxy team Hi There Im trying to map RNA-seq data to a reference genome in Galaxy (Main instance) using both Bowtie 1 and Bowtie 2. Im currently using publicly available data (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28755) which is not available in FASTQ format - only the raw sequences with the read count. Is there a way to set the input data for bowtie to raw, as is possible using the terminal? Or is there a way to convert a raw sequence to FASTQ (not sure if this would work, but it might be possible if I assigned accession numbers to each sequence and made all the quality scores identical)? Thanks very much Jonathan Glass Disclaimer - University of Cape Town This e-mail is subject to the UCT ICT policies and e-mail disclaimer published on our website at http://www.uct.ac.za/about/policies/emaildisclaimer/ or obtainable from +27 21 650 9111. If this e-mail is not related to the business of UCT it is sent by the sender in the sender's individual capacity. ___________________________________________________________ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org<http: usegalaxy.org="">. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org Disclaimer - University of Cape Town This e-mail is subject to the UCT ICT policies and e-mail disclaimer published on our website at http://www.uct.ac.za/about/policies/emaildisclaimer/ or obtainable from +27 21 650 9111. If this e-mail is not related to the business of UCT it is sent by the sender in the sender's individual capacity.
ADD REPLY • link written 5.1 years ago by Jonathan Glass • 20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 175 users visited in the last hour