Question: Bed To Gff
0
gravatar for Robin Mjelle
6.7 years ago by
Robin Mjelle • 20
Robin Mjelle • 20 wrote:
Dear Galaxy I have a problem converting Interval to GFF. I used the tool BED-to- GFF<http: main.g2.bx.psu.edu="" tool_runner?tool_id="bed2gff1">converter. My Interval file contains 18 coulmns: *chr1 33308998 33309020 + cel-let-7-5p 0 chr1 33308999 255 22M * 0 0 AGAGGAAGAAGGAAGAAAAGAA UGAGGUAGUAGGUUGUAUAGUU XA:i:0 MD:Z:22 NM:i:0* However my GFF output only contains 9, and it has removed the feature "* cel-let-7-5p":* chr1 bed2gff region_0 33308999 33309020 0 + . region_0; Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this? Best Robin
gff • 1.1k views
ADD COMMENT • link • modified 6.7 years ago by Jennifer Hillman Jackson ♦ 25k • written 6.7 years ago by Robin Mjelle • 20
0
gravatar for Jennifer Hillman Jackson
6.7 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:
Hello, The first input file is not in BED format (specifically, BED12). This would be necessary in order to produce a GFF file with the proper attributes in the feature, frame, and group fields. The tool BED-to-GFF describes these formats. BED12 files are available from the UCSC table browser and certain other sources. These should not be confused with BED6 files, which are the most common BED format in Galaxy. Best wishes for your project, Jen Galaxy team
ADD COMMENT • link written 6.7 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 175 users visited in the last hour