Question: How To Clip Multiple Adapter Sequences In Penn State Galaxy? Thank.
0
gravatar for Binbin You
7.2 years ago by
Binbin You • 50
Binbin You • 50 wrote:
Hi All, In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip.  In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. So how could i do if  I have the adapter sequences like this:                           5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much  for any response! Best wishes, Bin
galaxy • 929 views
ADD COMMENT • link • written 7.2 years ago by Binbin You • 50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 165 users visited in the last hour