Question: Confusing FastX_Barcode_Splitter Error
1
gravatar for mccoykg
3.4 years ago by
mccoykg • 80
United States
mccoykg • 80 wrote:

Hi all, I'm trying to use the improved barcode splitter tool, but whenever I use it I get the below error. My barcode file is in the standard format (each line has a name then space then its associated barcode) and the FASTQ file I'm entering has been properly groomed beforehand. Any help would be much appreciated.

 

zcat: can't stat: /Users/vanopijn/galaxy/database/files/000/dataset_439.dat (/Users/vanopijn/galaxy/database/files/000/dataset_439.dat.Z): No such file or directory
Use of uninitialized value $first_char in ord at /Users/vanopijn/galaxy/dependencies/fastx_toolkit/0.0.13/devteam/package_fastx_toolkit_0_0_13/ec66ae4c269b/bin/fastx_barcode_splitter.pl line 335.
Use of uninitialized value $first_char in string eq at /Users/vanopijn/galaxy/dependencies/fastx_toolkit/0.0.13/devteam/package_fastx_toolkit_0_0_13/ec66ae4c269b/bin/fastx_barcode_splitter.pl line 337.
Use of uninitialized value $first_char in string eq at /Users/vanopijn/galaxy/dependencies/fastx_toolkit/0.0.13/devteam/package_fastx_toolkit_0_0_13/ec66ae4c269b/bin/fastx_barcode_splitter.pl line 341.
Use of uninitialized value $first_char in concatenation (.) or string at /Users/vanopijn/galaxy/dependencies/fastx_toolkit/0.0.13/devteam/package_fastx_toolkit_0_0_13/ec66ae4c269b/bin/fastx_barcode_splitter.pl line 346.
Error: unknown file format. First character = '' (expecting > or @)
sed: 2: "
i<tr><td>
s|\t|</td><t ...": command i expects \ followed by text
sed: illegal option -- r
usage: sed script [-Ealn] [-i extension] [file ...]
       sed [-Ealn] [-i extension] [-e script] ... [-f script_file] ... [file ...]
fastx_barcode_splitter • 1.6k views
ADD COMMENT • link • modified 3.1 years ago by Lance Parsons • 110 • written 3.4 years ago by mccoykg • 80

you're working on the public galaxy server?

ADD REPLY • link written 3.4 years ago by vowinkel.alexander • 10

No, I'm working on a local instance. I've just downloaded the fastX_Barcode_Splitter, and not made any changes to it.

ADD REPLY • link written 3.4 years ago by mccoykg • 80

I am having the same problem. Any help would be welcomed.

ADD REPLY • link written 3.3 years ago by super.gero • 0
3
gravatar for Lance Parsons
3.1 years ago by
Lance Parsons • 110
United States
Lance Parsons • 110 wrote:

I've pushed an update to the toolshed (https://toolshed.g2.bx.psu.edu/view/lparsons/fastx_barcode_splitter_enhanced/b7b3d008e2d3) that addresses this issue.

The problem was with the use of sed in the fastx_toolkit script. It assumed GNU Sed, but OSX uses BSD Sed. I replaced that use of Sed with a perl one-liner. I tested on OSX 10.11.1 and on Ubuntu 15.07. Let me know if anyone continues to experience issues.

Sorry for the long delay, I wasn't aware of the issue until just recently.

ADD COMMENT • link written 3.1 years ago by Lance Parsons • 110

Thank you so much!

ADD REPLY • link written 3.1 years ago by mccoykg • 80

I've actually just tested it, and it returns an error when I try to use it, like so: http://postimg.org/image/qbeff6okf/

I'm running OSX 10.10.2, if that's helpful. Do you know if there's a way to download the older version in the meantime? Thank you for this!
 

ADD REPLY • link modified 3.1 years ago • written 3.1 years ago by mccoykg • 80
I'm not sure what that error means, but I'd suggest one thing. Be sure you restart Galaxy after installing the tool. Second, click to report error button (the little bug icon) and let us know what the full error message is.
ADD REPLY • link written 3.1 years ago by lanceparsons1 • 0

I've restarted Galaxy, and unfortunately barcode splitter still isn't working. When I push the report error button I get an error saying "An error occurred sending the report by email: Error reporting has been disabled for this galaxy instance"

However, when re-running it, I realized there was a more detailed error description; I hope this is helpful:

Traceback (most recent call last):
  File "/home/galaxy/galaxy/lib/galaxy/jobs/runners/local.py", line 129, in queue_job
    job_wrapper.finish( stdout, stderr, exit_code )
  File "/home/galaxy/galaxy/lib/galaxy/jobs/__init__.py", line 1300, in finish
    'primary': self.tool.collect_primary_datasets(out_data, self.working_directory, input_ext)
  File "/home/galaxy/galaxy/lib/galaxy/tools/__init__.py", line 2239, in collect_primary_datasets
    return output_collect.collect_primary_datasets( self, output, job_working_directory, input_ext )
  File "/home/galaxy/galaxy/lib/galaxy/tools/parameters/output_collect.py", line 224, in collect_primary_datasets
    raise Exception( "Problem parsing metadata fields for file %s" % filename )
Exception: Problem parsing metadata fields for file ./database/tmp/primary_4540_unmatched_visible.fastqsanger

The barcode splitter worked beautifully before on our linux-based server and retured the original zcat: can't stat error on our mac local instance, but this error was on our server instance, if that's useful.

ADD REPLY • link written 3.1 years ago by mccoykg • 80

Oh, also - I don't know if this is possible, but is there some way you could offer the old version as an option to download? We've got some pipelines that rely on the barcode splitter tool, and another lab just asked if we could share them, so it would be great if they could have access to the old version.

ADD REPLY • link written 3.1 years ago by mccoykg • 80

The error you posted is a Galaxy error that occurred after the tool was run, and is not part of the tool itself. If possible, could you paste the first few lines of the file `./database/tmp/primary_4540_unmatched_visible.fastqsanger`? It seems that Galaxy was having problems parsing that file for some reason.

The new version and old version take the same input and provide the same output, so there is no tool version difference. That said, it is possible to download old revisions of tools from the toolshed and install them manually.

ADD REPLY • link written 3.1 years ago by Lance Parsons • 110

Sure thing! Here's the first few lines:

@DGL9ZZQ1:555:C4UUYACXX:2:1101:1465:2228 1:N:0:
ATGGCCATCGGTCAAAACATTAACA
+
?FFFEEFGH?HGHGEI@;BFHEIID
@DGL9ZZQ1:555:C4UUYACXX:2:1101:1532:2244 1:N:0:
CTTAAGTGGCTGGAGACAAATAATC
+
HHHFIFGIIHGIF>GCEFCGDBG<F
@DGL9ZZQ1:555:C4UUYACXX:2:1101:1984:2217 1:N:0:
CTTAACGCTATAAGTTATTATAACA
+
FHHHE<AEGIBHGHFHGGIIIGIII
@DGL9ZZQ1:555:C4UUYACXX:2:1101:1983:2244 1:N:0:
TCTGAATGTCACGCTGATTATTTTG
+
HBFAEHGII<??FEFAGHIIIEDG*
@DGL9ZZQ1:555:C4UUYACXX:2:1101:2232:2215 1:N:0:
TTGAACGGCGTCGCGTCGTAACCCA
+
HHHHIGGIEIHIJGIJHIHIIIJII

Sorry to bother you about this, but how do you download old revisions? I can't find it on the tool page.

ADD REPLY • link written 3.1 years ago by mccoykg • 80

There doesn't appear to be anything wrong at the start of that file. Perhaps the problem is later in the file. You could try importing that file into the public Galaxy instance to see if it also has a problem with it?

You can't install the old revision from the toolshed directly, but if you click on the "revisions" link you can go to specific revisions and download them (as a tar.gz file). Alternatively, you can clone the repository yourself if you are familiar with using Mercurial.

I'm sorry I can't help you further, but at the moment, I'm not able to reproduce the errors you are seeing.

ADD REPLY • link written 3.1 years ago by Lance Parsons • 110

Thank you for all your help! I've been trying to install the old version, but I can't find it either in your github or in the toolshed. In the toolshed I've found two "changesets" - b7b3d008e2d3 and 84bbf4fd24c3 - but both are version 1.1. Is there anyway you could link me to either the Galaxy toolshed page for downloading the 1.0.0 revision or get me a link to clone it?

I've also been messing around trying to get the 1.1 version to run on my local instance, but it doesn't work no matter which FASTA or FASTQ files I use. I've even tried downloading a local instance to my personal laptop and testing the Barcode Splitter tool on it; it returns the same unhelpful

Exception: Problem parsing metadata fields for file ./database/tmp/primary_4540_unmatched_visible.fastqsanger

But yeah - a link to the old version would be really great. Thank you!

ADD REPLY • link written 3.0 years ago by mccoykg • 80

Long story short, there is an update on the toolshed that should resolve the issue. After you update the tool, be sure to reload the tool configuration (or restart galaxy).

Thanks for the detailed testing. I'm still not entirely sure what was wrong, but Galaxy changed how it handles multiple output files, so I updated the code to use the new mechanism. 

Let me know how it works out, sorry for all of the issues.

ADD REPLY • link written 3.0 years ago by Lance Parsons • 110

I just tried it and it works perfectly! It also works on the Mac instance! Thank you so much. :)

ADD REPLY • link modified 3.0 years ago • written 3.0 years ago by mccoykg • 80
1
gravatar for Jennifer Hillman Jackson
3.3 years ago by
United States
Jennifer Hillman Jackson ♦ 25k wrote:

Hello,

This would be a good error to report directly to the tool author (Lance Parsons) through the Tool Shed interface. Be sure you are logged in, click into the tool, then find the option in the upper top right menu Repository Actions -> Contact Repository Owner.

You could also try to reach him on the galaxy-dev@lists.galaxyproject.org mailing list, but that is not as direct and he may or may not be watching the list right now.

Any resolution can be posted back here, to aid others using Galaxy Biostars.

Best, Jen, Galaxy team 

ADD COMMENT • link modified 3.3 years ago • written 3.3 years ago by Jennifer Hillman Jackson ♦ 25k

Hey! I had forgotten about this issue and run into the problem again, and then I realized I never contacted the author. However, I just clicked into the tool and the only options are Install to Galaxy, Browse Repository, and Toolshed Actions - I can't find a contact option. Do you know if that's still available somewhere?

Thanks,

Kay

ADD REPLY • link written 3.1 years ago by mccoykg • 80
1

I see that the problem was solved, but for any others that might come across these posts: 

Log into the Tool Shed to see all repository actions (including contacting the repo owner). And sometimes they also see questions here and respond directly :)

ADD REPLY • link written 3.0 years ago by Jennifer Hillman Jackson ♦ 25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 16.09
Traffic: 169 users visited in the last hour